Sequence ID | >W1911682488 |
Genome ID | QKOJ01000002 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Bifidobacterium longum subsp. longum C11A10B [QKOJ] |
Start position on genome | 208918 |
End posion on genome | 208833 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
acgcgcatca |
tRNA gene sequence |
GGACAGGTGTCTGAGCGGCCTAAAGAGACGGTCTTGAAAACCGTTGAGGGGCAACCCTCC |
Downstream region at tRNA end position |
accgaggcct |
Secondary structure (Cloverleaf model) | >W1911682488 Ser TGA a GCga accgaggcct G - C G - C A - T C - G A - T G - C G - C T A T C G C T C A C G A G | | | | | G G G T C T G C G A G C G | | | T T C A A G A C T A G TGAGGGGCAACCCTCC A - T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |