Sequence ID | >W1911696568 |
Genome ID | QMEK01000003 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Tropicimonas sp. IMCC34043 [QMEK] |
Start position on genome | 215926 |
End posion on genome | 216001 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
cgcgggccgt |
tRNA gene sequence |
AGGGGTATAGCTCAGCTGGTAGAGCGACGGTCTCCAAAACCGTAGGTCGCGGGTTCGAGC |
Downstream region at tRNA end position |
ttcaatccat |
Secondary structure (Cloverleaf model) | >W1911696568 Trp CCA t GCCA ttcaatccat A - T G - C G - C G - C G - C T + G A - T C G T C G T C C A C G A A | | + | | G T C T C G G C G G G C G | | | | T T G G A G C T A G AGGTC A - T C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |