Sequence ID | >W1911709127 |
Genome ID | QPGS01000018 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Porphyromonas gingivalis 381OKJP [QPGS] |
Start position on genome | 21739 |
End posion on genome | 21655 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
caattttttt |
tRNA gene sequence |
GCGCGGGTGGTGGAATTGGTAGACACGCTACTTTGAGGGGGTAGTGCCGGTTACGGTGTG |
Downstream region at tRNA end position |
ttaatgaaga |
Secondary structure (Cloverleaf model) | >W1911709127 Leu GAG t ACtt ttaatgaaga G + T C - G G - C C - G G - C G + T G - C T A T T A C T C A T A A G + | | | | A T G G T G G T G A G C G | | | T T G A C A C T A G G TGCCGGTTACGGTGT C - G T - A A - T C - G T + G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |