Sequence ID | >W1911709191 |
Genome ID | QPHM01000003 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Haloplanus salinus JCM 18368 [QPHM] |
Start position on genome | 162264 |
End posion on genome | 162190 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
cagtcctcgT |
tRNA gene sequence |
GAGCCGATAGTCCAGCGGACGACGATCTGTGCTTTGGGCGCACAGGACCGAGGTTCGAAT |
Downstream region at tRNA end position |
tgccgtgtct |
Secondary structure (Cloverleaf model) | >W1911709191 Pro TGG T AGtg tgccgtgtct G - C A - T G - C C - G C - G G - C A - T T A T G C T C C A C G A A | | | | | G G C C T G C G A G G C G | | + T T A C G A T C G A C GGAC T - A G - C T - A G - C C - G T C T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |