Sequence ID | >W1911709743 |
Genome ID | QPLT01000011 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Halorubrum sp. Atlit-26R [QPLT] |
Start position on genome | 55360 |
End posion on genome | 55287 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
cggccgaccc |
tRNA gene sequence |
GGATCGATAGCTCAGTCTGGGAGAGCACCGGCCTGAAGCGCTGGCATGCCTCGGTTCGAA |
Downstream region at tRNA end position |
cccgagggcg |
Secondary structure (Cloverleaf model) | >W1911709743 Phe GAA c Atct cccgagggcg G - C G - C A - T T - A C - G G - C A - T T A T G A G C C A T G A A | | | | | G C C T C G C T C G G C T | | | | T T G G A G C G G A A CATGC C - G C - G G + T G - C C - G C C T G G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |