Sequence ID | >SRA1000165 |
Genome ID | SRR001036.201798 |
Search identical group | |
Phylum/Class | Marine Viruses from Arctic Ocean (SRP000129) |
Species | |
Start position on genome | 86 |
End posion on genome | 12 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
cccaagggat |
tRNA gene sequence |
GGGCGTGTAGCTCAGTGGTAGAGCACTGTGTTGACATCGCAGGGGTCGCAAGTTCAATCC |
Downstream region at tRNA end position |
ttaaaaacgc |
Secondary structure (Cloverleaf model) | >SRA1000165 Val GAC t ACCA ttaaaaacgc G - C G - C G - C C - G G - C T - A G - C C T T C G T T C A G A A | | | | | A T C T C G G C A A G C G | | | | T T G G A G C T A A GGGTC C - G T - A G - C T + G G - C T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |