| Sequence ID | >SRA1000210 |
| Genome ID | SRR001037.50221 |
| Phylum/Class | Marine Viruses from Arctic Ocean (SRP000129) |
| Species | |
| Start position on genome | 7 |
| End posion on genome | 98 |
| Amino Acid | Ser |
| Anticodon | GCT |
| Upstream region at tRNA start position |
nnnnccatgc |
| tRNA gene sequence |
GGAGACGTGGGTGAGTGGCTGAAACCAACGGTTTGCTAAACCGTCGTGCTGTGAATGCGG |
| Downstream region at tRNA end position |
cttctttttc |
| Secondary structure (Cloverleaf model) | >SRA1000210 Ser GCT
c GCCA cttctttttc
G - C
G - C
A - T
G - C
A - T
C - G
G - C T A
T C T C C C A
T G A G | | | | | G
G G T G G G A G G G C
G | | | T T
C A A C C
T G A A CGTGCTGTGAATGCGGCACC
A - T
C - G
G - C
G - C
T - A
T A
T A
G C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |