| Sequence ID | >SRA1000225 |
| Genome ID | SRR001037.144762 |
| Phylum/Class | Marine Viruses from Arctic Ocean (SRP000129) |
| Species | |
| Start position on genome | 3 |
| End posion on genome | 79 |
| Amino Acid | Arg |
| Anticodon | CCT |
| Upstream region at tRNA start position |
nnnnnnnngc |
| tRNA gene sequence |
GCACCCGTAGCTCAGCAGGATAGAGCATCAGATTCCTAATCTGGGGGCCGTGGGTTCGAA |
| Downstream region at tRNA end position |
tctattcaat |
| Secondary structure (Cloverleaf model) | >SRA1000225 Arg CCT
c ACCA tctattcaat
G - C
C - G
A - T
C - G
C - G
C - G
G - C T A
T C G C C C A
C G A A | + | | | G
A C T C G G T G G G C
G | | | | T T
G G A G C
A T A A GGGCC
T + G
C - G
A - T
G - C
A - T
T A
T A
C C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |