Sequence ID | >W1911722812 |
Genome ID | QREL01000004 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanothermobacter defluvii DSM 7466 [QREL] |
Start position on genome | 111716 |
End posion on genome | 111800 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
ctatggtaag |
tRNA gene sequence |
GCCGGGGTGGCCCAGTCTGGTACGGCGTTGGCCTGCTAAGCCAATGATCCTTTGGATCTC |
Downstream region at tRNA end position |
tttcctgatt |
Secondary structure (Cloverleaf model) | >W1911722812 Ser GCT g Gtct tttcctgatt G - C C - G C - G G - C G - C G - C G - C T A T T G C C C A T G A G + | | | | A C C C C G G C G G G C T | | | T T G C G G C G T A G TGATCCTTTGGATCTC T - A T - A G - C G - C C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |