Sequence ID | >SRA1000342 |
Genome ID | SRR001041.55345 |
Search identical group | |
Phylum/Class | Line Islands Corals, microbial fraction of Christmas Atoll (SRP000133) |
Species | |
Start position on genome | 11 |
End posion on genome | 85 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
cggcgggaac |
tRNA gene sequence |
GGGCGATTAGCTCAGCGGTAGAGCACTTCGTTGACATCGAAGGGGTCACTGGTTCGATCC |
Downstream region at tRNA end position |
tgaaccgccg |
Secondary structure (Cloverleaf model) | >SRA1000342 Val GAC c ACCA tgaaccgccg G - C G - C G - C C - G G - C A - T T - A C T T T G A C C A G A A | | | | | G C C T C G A C T G G C G | | | | T T G G A G C T A A GGGTC C - G T - A T - A C - G G - C T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |