Sequence ID | >SRA1000364 |
Genome ID | SRR001042.2573 |
Search identical group | |
Phylum/Class | Line Islands Corals, viral fraction of Christmas Atoll (SRP000134) |
Species | |
Start position on genome | 26 |
End posion on genome | 99 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
ttggggttgt |
tRNA gene sequence |
GCGGGTGTAGTTCAATGGTAGAACGCTAGCCTTCCAAGTTGGATGTAAGGGTTCGATTCC |
Downstream region at tRNA end position |
agaaattaag |
Secondary structure (Cloverleaf model) | >SRA1000364 Gly TCC t TCCA agaaattaag G - C C - G G - C G - C G - C T - A G + T T T T T T C C C A A A A | | | | | G T C T T G A A G G G C G | | | | T T G G A A C T A G ATGT C - G T + G A - T G + T C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |