Sequence ID | >W1911737962 |
Genome ID | QTZN01000010 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Labilibaculum euxinus A4 [QTZN] |
Start position on genome | 151952 |
End posion on genome | 152026 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
gaagttatac |
tRNA gene sequence |
TCCTTCTTAGCTCAGTTGGTTAGAGCATCTGACTGTTAATCAGAGGGTCCTAGGTTCAAG |
Downstream region at tRNA end position |
aaaaaaagca |
Secondary structure (Cloverleaf model) | >W1911737962 Asn GTT c GCaa aaaaaaagca T - A C - G C - G T + G T - A C - G T - A T G T G A T C C A T G A A | | | | | A T C T C G C T A G G C G | | | | T T G G A G C T T A A GGGTC T - A C - G T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |