Sequence ID | >SRA1000519 |
Genome ID | SRR001042.310177 |
Search identical group | |
Phylum/Class | Line Islands Corals, viral fraction of Christmas Atoll (SRP000134) |
Species | |
Start position on genome | 99 |
End posion on genome | 23 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
nnnnnnnntt |
tRNA gene sequence |
GGGGAATTAGCTCAGCTGGCTAGAGCACTTGATTTGCATTCAAGAGGTCGTGGGTTCGAC |
Downstream region at tRNA end position |
aaacgttcat |
Secondary structure (Cloverleaf model) | >SRA1000519 Ala TGC t ACTA aaacgttcat G - C G - C G + T G - C A - T A - T T - A T C T C A C C C A C G A A | | | | | G T C T C G G T G G G C G | | | | T T G G A G C C T A A AGGTC C - G T - A T - A G - C A - T T T T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |