Sequence ID | >SRA1000541 |
Genome ID | SRR001043.86209 |
Search identical group | |
Phylum/Class | Stromatolites, microbial fraction from Rios Mesquites microbiolite in Cuatro Cienagas, Mexico (SRP000135) |
Species | |
Start position on genome | 7 |
End posion on genome | 80 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
nnnttcgcgT |
tRNA gene sequence |
TCCTCAGTAGCTCAGTGGTAGAGCGGTCGGCTGTTAACCGATTGGTCGCAGGTTCGAATC |
Downstream region at tRNA end position |
ttgtcttttt |
Secondary structure (Cloverleaf model) | >SRA1000541 Asn GTT T GTtt ttgtcttttt T - A C - G C - G T + G C - G A - T G - C T A T C G T C C A G A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C T A G TGGTC G + T T - A C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |