Sequence ID | >SRA1000652 |
Genome ID | SRR001045.328814 |
Search identical group | |
Phylum/Class | Stromatolites, viral fraction from Rios Mesquites microbiolite in Cuatro Cienagas, Mexico (SRP000137) |
Species | |
Start position on genome | 108 |
End posion on genome | 31 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
nnnttggaaa |
tRNA gene sequence |
GCCCTTATAACATAATCGGTTAATGTAAACACCTCATAAGTGTGAGAAGGAGCGGTTCGA |
Downstream region at tRNA end position |
ccttaacaat |
Secondary structure (Cloverleaf model) | >SRA1000652 Met CAT a ACCA ccttaacaat G - C C - G C - G C - G T + G T - A A - T T A T C C G C C A T A A A | | | | G C T A C A A G C G G C G | | | | T T G A T G T T T A A AGAAGG A G A - T C - G A - T C - G C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |