Sequence ID | >SRA1000673 |
Genome ID | SRR001046.43334 |
Search identical group | |
Phylum/Class | Solar Salterns, microbial fraction from low salinity saltern in San Diego, CA (SRP000138) |
Species | |
Start position on genome | 8 |
End posion on genome | 82 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
nnncggtcga |
tRNA gene sequence |
CGGGGCGTAGCGCAGCCTGGTAGCGCATCTGCTTTGGGAGCAGAGGGTCGCTGGTTCGAA |
Downstream region at tRNA end position |
tttcnnnnnn |
Secondary structure (Cloverleaf model) | >SRA1000673 Pro TGG a ACtc tttcnnnnnn C - G G - C G - C G - C G - C C - G G - C T A T T G A C C A C G A A + | | | | G C C G C G G C T G G C T | | | | T T G G C G C G T A A GGGTC T - A C - G T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |