| Sequence ID | >W1911765343 |
| Genome ID | QXCP01000005 |
| Phylum/Class | Actinomycetota |
| Species | Brachybacterium sp. EE-P12 [QXCP] |
| Start position on genome | 29172 |
| End posion on genome | 29244 |
| Amino Acid | Val |
| Anticodon | CAC |
| Upstream region at tRNA start position |
cggcacctca |
| tRNA gene sequence |
GGGCGATTGGCGCAGGGGTAGCGCGCTTCCTTCACACGGAAGAGGTCACTGGTTCGATCC |
| Downstream region at tRNA end position |
caggatcctt |
| Secondary structure (Cloverleaf model) | >W1911765343 Val CAC
a ACgg caggatcctt
G - C
G - C
G - C
C - G
G - C
A - T
T - A C T
T T G A C C A
G A G | | | | | G
G C G C G A C T G G C
G | | | | T T
G G C G C
T A G AGGTC
C - G
T - A
T - A
C - G
C - G
T C
T A
C A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |