Sequence ID | >W1911766828 |
Genome ID | QXED01000011 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Fibrisoma montanum HYT19 [QXED] |
Start position on genome | 45448 |
End posion on genome | 45530 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
cgggctacct |
tRNA gene sequence |
GCGGGCGTGGCGAAATTGGTAGACGTGCCAGACTTAGGATCTGGTGCCGCAAGGCATGGG |
Downstream region at tRNA end position |
agttttgaat |
Secondary structure (Cloverleaf model) | >W1911766828 Leu TAG t ACaa agttttgaat G + T C - G G - C G - C G - C C - G G - C T G T C T C C C A T A A G | + | | | G T A G C G G G G G G C G | | + T T G A C G T T A G G TGCCGCAAGGCAT C - G C - G A - T G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |