Sequence ID | >W1911770037 |
Genome ID | QXIK01000006 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Haloarcula sp. Atlit-7R [QXIK] |
Start position on genome | 257329 |
End posion on genome | 257248 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
cgcggaatgc |
tRNA gene sequence |
GTCGCTATACCCAAGTGGTCAACGGGGCACGGTTGAGGGCCGTGTGTGCAGACTATCGCA |
Downstream region at tRNA end position |
tggctgtggc |
Secondary structure (Cloverleaf model) | >W1911770037 Leu GAG c Atgc tggctgtggc G - C T - A C - G G - C C - G T + G A - T T A T C G T C C A T G A A | | | | | G G A C C C G C A G G C G | | | T T T C G G G C A A G TGTGCAGACTATC C - G A - T C - G G - C G - C T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |