Sequence ID | >SRA1000724 |
Genome ID | SRR001046.185644 |
Search identical group | |
Phylum/Class | Solar Salterns, microbial fraction from low salinity saltern in San Diego, CA (SRP000138) |
Species | |
Start position on genome | 37 |
End posion on genome | 109 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
cttcaggtta |
tRNA gene sequence |
GCCGGTGTAGCTCAGGGGTAGAGCGTTTCCTTGGTAAGGAAGAGGCCACGGGTTCAAATC |
Downstream region at tRNA end position |
aaacagacta |
Secondary structure (Cloverleaf model) | >SRA1000724 Thr GGT a TCtg aaacagacta G - C C - G C - G G + T G + T T - A G - C T A T T G C C C A G A A | | | | | A G C T C G A C G G G C G | | | | T T G G A G C T A G AGGCC T + G T - A T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |