Sequence ID | >SRA1000729 |
Genome ID | SRR001046.217693 |
Search identical group | |
Phylum/Class | Solar Salterns, microbial fraction from low salinity saltern in San Diego, CA (SRP000138) |
Species | |
Start position on genome | 7 |
End posion on genome | 80 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
nnnngcccac |
tRNA gene sequence |
GGGCGATTGGCGCAGGGGCTAGCGCGCTTCCTTGACACGGAAGAGGTCACTGGTTCGATT |
Downstream region at tRNA end position |
atcctcctca |
Secondary structure (Cloverleaf model) | >SRA1000729 Val GAC c ACan atcctcctca G - C G - C G - C C - G G - C A - T T - A T T T T G A C C A G G A G | | | | | G G C G C G A C T G G C G | | | | T T C G C G C T A G AGGTC C - G T - A T - A C - G C - G T C T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |