Sequence ID | >SRA1000942 |
Genome ID | SRR001049.245820 |
Search identical group | |
Phylum/Class | Line Islands Corals, viral fraction from water of Palmyra (SRP000141) |
Species | |
Start position on genome | 1 |
End posion on genome | 76 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
nnnnnnnnnn |
tRNA gene sequence |
GGGGGTATAGTTCAGTTGGGAGAACGTCTGCCTTGCACGCAGAAGGTCGTGGGTTCGAAT |
Downstream region at tRNA end position |
tttcaaggct |
Secondary structure (Cloverleaf model) | >SRA1000942 Ala TGC n ACCA tttcaaggct G - C G - C G + T G - C G - C T - A A - T T A T C G C C C A T G A A | + | | | G T C T T G G T G G G C G | | | | T T G G A A C G A G AGGTC T - A C - G T - A G - C C - G C C T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |