| Sequence ID | >W1911802498 |
| Genome ID | QYUJ01000014 |
| Phylum/Class | Deinococcota |
| Species | Deinococcus cavernae K2S05-167 [QYUJ] |
| Start position on genome | 1970326 |
| End posion on genome | 1970401 |
| Amino Acid | Gly |
| Anticodon | GCC |
| Upstream region at tRNA start position |
tttttttatt |
| tRNA gene sequence |
GCGGGAGTAGCTCAGCTGGTAGAGCACTACCTTGCCAAGGTAGATGTCGCGAGTTCGAAT |
| Downstream region at tRNA end position |
ctccatagcc |
| Secondary structure (Cloverleaf model) | >W1911802498 Gly GCC
t TCCA ctccatagcc
G - C
C - G
G - C
G - C
G - C
A - T
G - C T A
T T G C T C A
C G A A + | | | | G
T C T C G G C G A G C
G | | | | T T
G G A G C
T A A ATGTC
C - G
T - A
A - T
C - G
C - G
T A
T A
G C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |