Sequence ID | >W1911802571 |
Genome ID | QYUK01000011 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Oleomonas cavernae K1W22B-8 [QYUK] |
Start position on genome | 3597382 |
End posion on genome | 3597306 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
aatgagagat |
tRNA gene sequence |
GCACCCGTAGCTCAGCTGGATAGAGCGCCACCCTCCGAAGGTGGAGGCCACACGTTCGAA |
Downstream region at tRNA end position |
tctctccctt |
Secondary structure (Cloverleaf model) | >W1911802571 Arg CCG t GCCA tctctccctt G - C C - G A - T C - G C - G C - G G - C T A T T G T G C A C G A A | | | | | G T C T C G A C A C G C G | | | | T T G G A G C A T A G AGGCC C - G C - G A - T C - G C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |