| Sequence ID | >W1911802882 |
| Genome ID | QYUQ01000002 |
| Phylum/Class | Betaproteobacteria |
| Species | Noviherbaspirillum sedimenti K1S02-23 [QYUQ] |
| Start position on genome | 306420 |
| End posion on genome | 306496 |
| Amino Acid | Ile |
| Anticodon | GAT |
| Upstream region at tRNA start position |
ctgatcaagc |
| tRNA gene sequence |
GGGTCTGTAGCTCAGCTGGTTAGAGCACCGTGTTGATAACGCGGGGGTCGTTGGTTCGAG |
| Downstream region at tRNA end position |
ggaatacggg |
| Secondary structure (Cloverleaf model) | >W1911802882 Ile GAT
c ACCA ggaatacggg
G - C
G - C
G - C
T - A
C - G
T - A
G - C C G
T C A A C C A
C G A A | | | | | G
T C T C G G T T G G C
G | | | | T T
G G A G C
T T A A GGGTC
C - G
C - G
G - C
T + G
G - C
T A
T A
G A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |