Sequence ID | >SRA1001128 |
Genome ID | SRR001052.190961 |
Search identical group | |
Phylum/Class | Corals, microbial fraction from Porites astreoides tissues (SRP000144) |
Species | |
Start position on genome | 75 |
End posion on genome | 1 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
tgttatctgg |
tRNA gene sequence |
CGGGGAGTGGCGCAGTCCGGTAGCGCATCTGGTTTGGGACCAGAGGGTCGCAGGTTCAAA |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >SRA1001128 Pro TGG g ACnn nnnnnnnnnn C - G G - C G - C G - C G - C A - T G - C T A T T G T C C A T G A G + | | | | A C C G C G G C A G G C C | | | | T T G G C G C G T A A GGGTC T - A C - G T - A G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |