Sequence ID | >SRA1001177 |
Genome ID | SRR001052.279531 |
Search identical group | |
Phylum/Class | Corals, microbial fraction from Porites astreoides tissues (SRP000144) |
Species | |
Start position on genome | 15 |
End posion on genome | 86 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
aatccgtccg |
tRNA gene sequence |
GGGGTTATAATTTAAAAGGCAAAATAGTCGGTTGTCATCCGATTAATGTGGGTTCAATTC |
Downstream region at tRNA end position |
tataaaatgg |
Secondary structure (Cloverleaf model) | >SRA1001177 Asp GTC g Gaat tataaaatgg G - C G - C G - C G + T T - A T - A A - T T T T T G T C C A A A A A + + + | | A A T T T A G T G G G C G | | | | T T G A A A T C A A TAAT G + T T - A C - G G - C G - C T T T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |