Sequence ID | >W1911817305 |
Genome ID | QZIA01000033 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Moraxella catarrhalis COPD_M7 [QZIA] |
Start position on genome | 12914 |
End posion on genome | 12839 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
cagtacctac |
tRNA gene sequence |
AGGGGTATCGCCAAGTTGGTAAGGCATCAGGTTTTGATCCTGACATTCGTTGGTTCGAGT |
Downstream region at tRNA end position |
tatccaaatt |
Secondary structure (Cloverleaf model) | >W1911817305 Gln TTG c GCCA tatccaaatt A - T G - C G + T G - C G - C T - A A - T T G T C G A C C A T G A C | + | | | G T A C C G G T T G G C G | | | T T G A G G C T A A CATTC T - A C - G A - T G - C G - C T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |