Sequence ID | >W1911824334 |
Genome ID | QZWE01000007 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Halococcus sp. IIIV-5B [QZWE] |
Start position on genome | 17369 |
End posion on genome | 17441 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
caacgaacga |
tRNA gene sequence |
AGTCCCGTGGTGTAGTGGCCAATCATAACGGCCTTTGGAGCCGTTGACGGCAGTTCGAAT |
Downstream region at tRNA end position |
ctgtcctttc |
Secondary structure (Cloverleaf model) | >W1911824334 Gln TTG a Atct ctgtcctttc A - T G - C T - A C - G C - G C - G G - C T A T C C G T C A T G A G | | | | | G G T G T G G G C A G C G | | + T T C T C A T C A A A TGAC A - T C - G G - C G - C C - G C A T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |