Sequence ID | >W1810004531 |
Genome ID | BFBD01000066 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Escherichia coli O157:H7 11279 [BFBD] |
Start position on genome | 588 |
End posion on genome | 512 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
tcggtattct |
tRNA gene sequence |
GCGTTGTTAGCTCAGCCGGACAGAGCAATTGCCTTCTAAGCAATCGGTCAGTGGTTCGAC |
Downstream region at tRNA end position |
cacttatttt |
Secondary structure (Cloverleaf model) | >W1810004531 Arg TCT t GCCA cacttatttt G - C C - G G - C T - A T - A G - C T - A T C T T C A C C A C G A A | | | | | G C C T C G A G T G G C G | | | | T T G G A G C A C A A CGGTC A - T T - A T - A G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |