| Sequence ID | >SRA1001529 |
| Genome ID | SRR001068.49956 |
| Phylum/Class | Tilapia Farm, microbial fraction from slime layer of hybrid striped bass from Kent SeaTech (Salton Sea, CA); fish were sick at time of sampling (SRP000156) |
| Species | |
|
Start position on genome
|
36
|
|
End posion on genome
|
111
|
|
Amino Acid
|
Glu
|
|
Anticodon
|
TTC
|
|
Upstream region at tRNA start position
|
ggattttcgt
|
|
tRNA gene sequence
|
GTCCCCATCGTCTAGAGGCCTAGGACACTGCCCTTTCACGGCTGTAACAGGGGTTCGAAT CCCCTTGGGGACGCCA
|
|
Downstream region at tRNA end position
|
ttccgataan
|
| Secondary structure (Cloverleaf model) | >SRA1001529 Glu TTC
t GCCA ttccgataan
G - C
T - A
C - G
C - G
C - G
C - G
A - T T A
T T C C C C A
A G A C | | | | | G
G T C T G A G G G G C
G + | | | T T
C G G A C
C T A A TAAC
C - G
T T
G - C
C - G
C - G
C C
T A
T T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |