| Sequence ID | >SRA1001567 |
| Genome ID | SRR001071.51276 |
| Phylum/Class | Tilapia Farm, viral fraction from slime layer of hybrid striped bass from Kent SeaTech (Salton Sea, CA); fish showed no sign of disease (SRP000159) |
| Species | |
|
Start position on genome
|
3
|
|
End posion on genome
|
77
|
|
Amino Acid
|
Asn
|
|
Anticodon
|
GTT
|
|
Upstream region at tRNA start position
|
nnnnnnnngt
|
|
tRNA gene sequence
|
GTCTCTGTGGCGCAATCGGCCAGCGCGCTCGGCTGTTAACCGAGAGGATGGGTGGTTCGA GCCCACCCAGGGCGTtac
|
|
Downstream region at tRNA end position
|
aaaaaccttc
|
| Secondary structure (Cloverleaf model) | >SRA1001567 Asn GTT
t Ttac aaaaaccttc
G G
T C
C - G
T + G
C - G
T - A
G - C C G
T C C A C C A
T A A G | | | | | G
C C G C G G G T G G C
G | | | | T T
G G C G C
C C A G AGGATG
C - G
T - A
C - G
G - C
G - C
C A
T A
G T T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |