Sequence ID | >SRA1001625 |
Genome ID | SRR001075.5508 |
Search identical group | |
Phylum/Class | Tilapia Farm, viral fraction from tilapia pond at Kent SeaTech (Salton Sea, CA) (SRP000163) |
Species | |
Start position on genome | 25 |
End posion on genome | 99 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
tcattggacc |
tRNA gene sequence |
GGGCACGTAGCTCAGCGGGAGAGCACCGCCTTGACATGGCGGGGGTCACAGGTTCAATCC |
Downstream region at tRNA end position |
tttnnnnnnn |
Secondary structure (Cloverleaf model) | >SRA1001625 Val GAC c ACCA tttnnnnnnn G - C G - C G - C C - G A - T C - G G - C C T T T G T C C A G A A | | | | | A C C T C G A C A G G C G | | | | T T G G A G C G A A GGGTC C - G C - G G - C C - G C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |