| Sequence ID | >SRA1001751 |
| Genome ID | SRR001308.30972 |
| Phylum/Class | Metagenomic characterization of a wastewater treatment plant (SRP000180) |
| Species | |
| Start position on genome | 132 |
| End posion on genome | 219 |
| Amino Acid | Leu |
| Anticodon | TAA |
| Upstream region at tRNA start position |
actttcccgc |
| tRNA gene sequence |
GCCGATGTGGTGAAATGGTAAACACAGCGGACTTAAAATCCGCTGGGGAGCAATCCCCTT |
| Downstream region at tRNA end position |
tttcacggca |
| Secondary structure (Cloverleaf model) | >SRA1001751 Leu TAA
c ACCA tttcacggca
G - C
C - G
C - G
G - C
A - T
T - A
G - C T G
T C G G C C A
T A A G | | | | | G
G A G T G G C C G G C
G | | | T T
T A C A C
A A A TGGGGAGCAATCCCCTT
G - C
C - G
G - C
G - C
A - T
C A
T A
T A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |