| Sequence ID | >W1810046047 |
| Genome ID | NGUI01000008 |
| Phylum/Class | Campylobacterota |
| Species | Campylobacter jejuni BD-75 [NGUI] |
| Start position on genome | 73375 |
| End posion on genome | 73301 |
| Amino Acid | Glu |
| Anticodon | TTC |
| Upstream region at tRNA start position |
ccttaaaagt |
| tRNA gene sequence |
GGCCCATTCGTCTAGCGGTTAGGACATCGCCCTTTCACGGCGGTAACACGAGTTCGAGTC |
| Downstream region at tRNA end position |
ctttttaatt |
| Secondary structure (Cloverleaf model) | >W1810046047 Glu TTC
t ACCA ctttttaatt
G - C
G + T
C - G
C - G
C - G
A - T
T - A T G
T T G C T C A
C G A C | | | | | G
G T C T G A C G A G C
G + | | | T T
T G G A C
T A A TAAC
T + G
C - G
G - C
C - G
C - G
C C
T A
T T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |