Sequence ID | >W1810046987 |
Genome ID | OKRE01000146 |
Search identical group | |
Phylum/Class | Acidobacteriota |
Species | Candidatus Sulfotelmatobacter sp. SbA7 SbA7 Peat soil MAG SbA7 [OKRE] |
Start position on genome | 2043 |
End posion on genome | 2116 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
ttctgctaac |
tRNA gene sequence |
AGCCCGGTCGTTCAACGGTAGGACTGCAGCCTCTGGAGCTGCGTATCGGGGTTCGAATCC |
Downstream region at tRNA end position |
aatttttcag |
Secondary structure (Cloverleaf model) | >W1810046987 Gln CTG c GCCA aatttttcag A - T G - C C - G C - G C - G G - C G - C T A T G T C C C A A A C | + | | | G C C T T G C G G G G C G | + | | T T G G G A C T A T GTAT G - C C - G A - T G - C C - G C A T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |