Sequence ID | >W1810047101 |
Genome ID | OMOD01000144 |
Search identical group | |
Phylum/Class | Acidobacteriota |
Species | Candidatus Sulfotelmatobacter kueseliae SbA1 Peat soil MAG SbA1 [OMOD] |
Start position on genome | 75613 |
End posion on genome | 75689 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aacaaagagt |
tRNA gene sequence |
GGCGGTGTAGCTCAGGTGGTTAGAGCGACGGTCTCATAATCCGTAGGTCGTTGGTTCGAG |
Downstream region at tRNA end position |
atcttctcaa |
Secondary structure (Cloverleaf model) | >W1810047101 Met CAT t ACCA atcttctcaa G - C G - C C - G G - C G - C T + G G - C T G T C A A C C A G G A A | | | | | G T C T C G G T T G G C G | | | | T T G G A G C T T A G AGGTC A - T C - G G - C G - C T T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |