Sequence ID | >W1810047237 |
Genome ID | OMOG01000348 |
Search identical group | |
Phylum/Class | Acidobacteriota |
Species | Candidatus Sulfopaludibacter sp. SbA4 SbA4 Peat soil MAG SbA4 [OMOG] |
Start position on genome | 2096 |
End posion on genome | 2019 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aggatagaag |
tRNA gene sequence |
TGCGGGGTGGAGCAGTCTGGTAGCTCGTTGGGCTCATAACCCAAAGGTCGGGTGGTTCAA |
Downstream region at tRNA end position |
agattctaga |
Secondary structure (Cloverleaf model) | >W1810047237 Met CAT g ACCA agattctaga T - A G - C C - G G - C G - C G - C G - C T A T C C A C C A T G A G | | | | | A C C G A G G G T G G C T | | | | T T G G C T C G T A G AGGTCG T - A T - A G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |