Sequence ID | >W1810047254 |
Genome ID | OMOG01000745 |
Search identical group | |
Phylum/Class | Acidobacteriota |
Species | Candidatus Sulfopaludibacter sp. SbA4 SbA4 Peat soil MAG SbA4 [OMOG] |
Start position on genome | 11678 |
End posion on genome | 11602 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gatctggtat |
tRNA gene sequence |
GGCGGCGTAGCTCAGCTGGCTAGAGCGAGGGTCTCATAATCCCTAGGTCCGCAGTTCGAG |
Downstream region at tRNA end position |
aattcccgaa |
Secondary structure (Cloverleaf model) | >W1810047254 Met CAT t ACCA aattcccgaa G - C G - C C - G G - C G - C C - G G - C T G T G C G T C A C G A A | | | | | G T C T C G C G C A G C G | | | | T T G G A G C C T A G AGGTC A - T G - C G - C G - C T T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |