Sequence ID | >W1810047262 |
Genome ID | OMSV01000134 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Syntrophobacter sp. SbD2 SbD2 Peat soil MAG SbD2 [OMSV] |
Start position on genome | 5499 |
End posion on genome | 5425 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
gatattgcgt |
tRNA gene sequence |
TGGGGCGTCGCCAAGCGGAAAGGCACGGGTCTTTGGAACCCGCATTCGGAGGTTCGAATC |
Downstream region at tRNA end position |
tttttttctt |
Secondary structure (Cloverleaf model) | >W1810047262 Gln TTG t GCCA tttttttctt T - A G - C G - C G - C G - C C - G G - C T A T C C T C C A G A C | | | | | G C A C C G G G A G G C G | | | T T G A G G C A A A CATTC C - G G - C G - C G - C T - A C A T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |