Sequence ID | >W1810049607 |
Genome ID | PCHI01000012 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Bifidobacterium pseudolongum subsp. pseudolongum 1370B [PCHI] |
Start position on genome | 22573 |
End posion on genome | 22658 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
attgcacaat |
tRNA gene sequence |
GGAGGATTCGCCTAGTGGCCTATGGCGCACGCTTGGAAAGCGTGTTGGTGTAACAGCCTC |
Downstream region at tRNA end position |
gtcatccgcc |
Secondary structure (Cloverleaf model) | >W1810049607 Ser GGA t GCtt gtcatccgcc G - C G - C A - T G - C G - C A - T T - A T A T C G C T C A T G A C | | | | | G G T C C G G C G A G C G | | | T T C T G G C C T A G TTGGTGTAACAGCCTC C - G A - T C - G G - C C - G T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |