Sequence ID | >W1810062707 |
Genome ID | PDOH01000036 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Halomonas heilongjiangensis 9月2日 [PDOH] |
Start position on genome | 4447 |
End posion on genome | 4358 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
attatctttc |
tRNA gene sequence |
GGAGAGATGGCCGAGTGGTTGATAGCTCCGGTCTTGAAAACCGGTATAGTTCTCTGCGAA |
Downstream region at tRNA end position |
cgcattaaat |
Secondary structure (Cloverleaf model) | >W1810062707 Ser TGA c Tttt cgcattaaat G - C G - C A - T G - C A - T G - C A - T T A T C T C C C A T G A G | | | | | G G G C C G G A G G G C G + | | T T T T A G C T G A T TATAGTTCTCTGCGAACTATC C - G C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |