Sequence ID | >W1810068025 |
Genome ID | PDZG01000007 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Iodobacter sp. BJB302 [PDZG] |
Start position on genome | 89545 |
End posion on genome | 89621 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
cagtttcatt |
tRNA gene sequence |
AGGGGAGTCGCCAAGTTGGTTAAGGCATCGGATTTTGATTCCGACATGCGAAGGTTCGAA |
Downstream region at tRNA end position |
atcattctca |
Secondary structure (Cloverleaf model) | >W1810068025 Gln TTG t GCCA atcattctca A - T G - C G - C G - C G - C A - T G + T T A T C T T C C A T G A C | | | | | G T A C C G G A A G G C G | | | T T G A G G C T T A A CATGC T - A C - G G - C G - C A - T T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |