Sequence ID | >W1810068784 |
Genome ID | PDZR01000004 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Methylocella silvestris TVC [PDZR] |
Start position on genome | 125813 |
End posion on genome | 125888 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cggccgcgcg |
tRNA gene sequence |
GGGCCGGTAGCTCAATGGTTAGAGCCGGCCGCTCATAACGGTCTGGTTGCAGGTTCGAGT |
Downstream region at tRNA end position |
gcatccgctg |
Secondary structure (Cloverleaf model) | >W1810068784 Met CAT g ACCA gcatccgctg G - C G - C G - C C - G C - G G - C G - C T G T C G T C C A T A A A | | | | | G G C T C G G C A G G C G | | | | T T T G A G C T A C TGGTT G - C G + T C - G C - G G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |