Sequence ID | >W1810069754 |
Genome ID | PEBS01000019 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Janthinobacterium sp. ROICE36 [PEBS] |
Start position on genome | 60064 |
End posion on genome | 60138 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
gattttttat |
tRNA gene sequence |
GCCCTTGTAGCTCAGTGGTAGAGCACTCCCTTGGTAAGGGAGAGGCCACGTGTTCGATCC |
Downstream region at tRNA end position |
gtatcctttc |
Secondary structure (Cloverleaf model) | >W1810069754 Thr GGT t ACCA gtatcctttc G - C C - G C - G C - G T - A T - A G - C C T T T G C A C A G A A | | | | | G T C T C G A C G T G C G | | | | T T G G A G C T A A AGGCC C - G T - A C - G C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |