Sequence ID | >W1810076225 |
Genome ID | PEIH01000004 |
Phylum/Class | Bacteroidota |
Species | Bacteroidetes bacterium endosymbiont of Geopemphigus sp. of Geopemphigus sp. GspS2-BC2016 [PEIH] |
Start position on genome | 155818 |
End posion on genome | 155891 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
tcagtgtatc |
tRNA gene sequence |
GCGAGAATAGCTCAGTTGGTAGAGCACGACCTTGCCAAGGTCGAGGTCGCGGGTTCGAAT |
Downstream region at tRNA end position |
aaaaatagaa |
Secondary structure (Cloverleaf model) | >W1810076225 Gly GCC c TCtc aaaaatagaa G - C C - G G - C A - T G - C A - T A - T T A T T G C C C A T G A A + | | | | G T C T C G G C G G G C G | | | | T T G G A G C T A A AGGTC C - G G - C A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |