Sequence ID | >W1810076231 |
Genome ID | PEIH01000005 |
Phylum/Class | Bacteroidota |
Species | Bacteroidetes bacterium endosymbiont of Geopemphigus sp. of Geopemphigus sp. GspS2-BC2016 [PEIH] |
Start position on genome | 419700 |
End posion on genome | 419777 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
gcaatagata |
tRNA gene sequence |
CGGGGTGTAGCGTAGTCCGGTCATCGCGCCTGGTTTGGGACCAGGAGGTCGCAGGTTCGA |
Downstream region at tRNA end position |
tattaagaaa |
Secondary structure (Cloverleaf model) | >W1810076231 Pro TGG a ACCA tattaagaaa C - G G - C G - C G - C G - C T - A G - C T A T C G T C C A C T G A A | | | | | G C T G C G G C A G G C G | | | T T G T C G C T C A G AGGTC C - G C - G T - A G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |