Sequence ID | >W1810076242 |
Genome ID | PEIH01000005 |
Phylum/Class | Bacteroidota |
Species | Bacteroidetes bacterium endosymbiont of Geopemphigus sp. of Geopemphigus sp. GspS2-BC2016 [PEIH] |
Start position on genome | 1039381 |
End posion on genome | 1039454 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tgccccatat |
tRNA gene sequence |
CGCGGGATGGAGCAGTTGGTAGCTCGTCGGGCTCATAACCCGAAGGTCACAGGTTCGAGT |
Downstream region at tRNA end position |
ttaattttta |
Secondary structure (Cloverleaf model) | >W1810076242 Met CAT t ACaa ttaattttta C T G - C C - G G - C G - C G - C A - T T G T T G T C C A T G A G | | | | | G T C G A G A C A G G C G | | | | T T G G C T C T A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |