Sequence ID | >W1810076243 |
Genome ID | PEIH01000005 |
Phylum/Class | Bacteroidota |
Species | Bacteroidetes bacterium endosymbiont of Geopemphigus sp. of Geopemphigus sp. GspS2-BC2016 [PEIH] |
Start position on genome | 855982 |
End posion on genome | 855911 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
tttttaatct |
tRNA gene sequence |
GGCACCGTGGCCGAGTGGCTAGGCAGAGGTCTGCAAAACCTTCTACAGCGGTTCGAATCC |
Downstream region at tRNA end position |
agtttttatg |
Secondary structure (Cloverleaf model) | >W1810076243 Cys GCA t TCtt agtttttatg G - C G - C C - G A - T C - G C - G G - C T A T T C G C C A G A G | | | | | G T G C C G A G C G G C G | | | T T G A G G C C T A CTAC G + T A - T G - C G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |