Sequence ID | >W1810076251 |
Genome ID | PEIH01000005 |
Phylum/Class | Bacteroidota |
Species | Bacteroidetes bacterium endosymbiont of Geopemphigus sp. of Geopemphigus sp. GspS2-BC2016 [PEIH] |
Start position on genome | 265162 |
End posion on genome | 265090 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
atagagtctc |
tRNA gene sequence |
GCCGATGTAGCTCAGGGGTAGAGCGCTTCCTTGGTAAGGAAGAGGTCACGGGTTCAATTC |
Downstream region at tRNA end position |
agaggcgtaa |
Secondary structure (Cloverleaf model) | >W1810076251 Thr GGT c TCaa agaggcgtaa G - C C - G C - G G + T A - T T - A G - C T T T T G C C C A G A A | | | | | A G C T C G A C G G G C G | | | | T T G G A G C T A G AGGTC C - G T - A T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |